other:Article Title: Cerebral Microvascular Injury Induced by Lag3‐Dependent α ‐Synuclein Fibril Endocytosis Exacerbates Cognitive Impairment in a Mouse Model of α ‐Synucleinopathies
Article Snippet: Host Dilution Tyrosine Hydroxylase (TH) Millipore (AB152) Rabbit 1:800 (IHC/IF) NeuN Abcam (ab177487) Rabbit 1:1000 (IHC) CD34 Santa Cruz (sc-7324) Mouse 1:200 (IF) IBA1 Abcam (ab283319) Mouse 1:400 (IF) GFAP Abcam (ab7260) Rabbit 1:400 (IF) AQP4 Abcam (ab9512) Mouse 1:200 (IF) Collagen IV Abcam (ab6585) Rabbit 1:200 (IF) α-Syn Abcam (ab212184) Rabbit 1:1000 (WB) p-α-Syn (Ser129) Abcam (ab 51253) Rabbit 1:500 (WB) 1:100 (IF) β-actin Cell Signaling (4970) Rabbit 1:1000 (WB) ZO-1 Abcam (ab96594) Rabbit 1:1000 (WB) Occludin Abcam (ab167161) Rabbit 1:1000 (WB) Claudin-5 Abcam (ab131259) Rabbit 1:1000 (WB) Rab7 Cell Signaling (2094) Rabbit 1:1000 (WB) PECAM (CD31) Cell Signaling (3528) Millipore (SAB5700639) Abcam (ab24590) Mouse Rabbit Mouse 1:1000 (WB) 1:100 (IF) Tuj-1 Proteintech (66375) Mouse 1:3000 (WB) 1:500 (IF) PAR Santa Cruz (sc-56198) Mouse 1:200 (WB) 1:50 (IF) γH2A.X Abcam (ab81299) Rabbit 1:5000 (WB) 1:500 (IF) Lag3 Abcam (209238, EPR20294) Millipore (MABF954,4-10-C9) Rabbit Mouse 1:1000 (WB) 1:300 (IF) α-SMA Proteintech (67735) Mouse 1:300 (IF) NG2 Santa Cruz (sc-53389) Mouse 1:150 (IF)
Article Title: Kindlin-3 Promotes Angiogenesis via Notch Signalling and Is Crucial for Functional Recovery Postmyocardial Infarction.
Article Snippet: Name of antibody Manufacturer Identifier Concentration Kindlin- 3 Affinity Biosciences DF13558 1:1000 (WB), 1:200 (IHC) VEGF Proteintech 19003- 1- AP 1:1000 (WB) β1- integrin Bioss bs- 0486R 1:2000 (WB), 1:400 (IHC) GAPDH Proteintech 6004- 1- Ig 1:2000 (WB) Hif- 1α Affinity Biosciences BF8002 1:2000 (WB) eNOS Proteintech 27120- 1- AP 1:1000 (WB) p- eNOS Proteintech 28937- 1- AP 1:1000 (WB) CD31 Proteintech 11265- 1- AP 1:1000 (WB), 1:400 (IF) Cleaved Caspase 3 Cell Signaling Technology 9664 1:1000 (WB) Caspase 3 Cell Signaling Technology 9662 1:1000 (WB) α- Actinin Sigma A7811 1:400 (IF) α- SMA Proteintech 14395- 1- AP 1:400 (IF) vWF Proteintech 66682- 1- Ig 1:400 (IF) Notch1 Proteintech 20687- 1- AP 1:1000 (WB), 1:400 (IHC) Hes1 Affinity Biosciences DF7569 1:1000 (WB) HRP- conjugated a Goat Anti- Rabbit Servicebio GB233303 1:200 (IHC) Goat Anti- Rabbit IgG, Peroxidase Conjugated, H + L Biosharp BL003A 1:10000 (WB) Goat Anti- Mouse IgG, Peroxidase Conjugated, H + L Biosharp BL001A 1:10000 (WB) Alexa Fluor 488- conjugated AffiniPure Goat AntiRabbit IgG (H + L) Jackson 115- 585- 003 1:200 (IF) Alexa Fluor 594- conjugated AffiniPure Goat AntiMouse IgG (H + L) Jackson 115- 585- 003 1:200 (IF) Abbreviations: IF, immunofluorescence; IHC, immunohistochemistry; WB, Western blot. nloaded from https://onlinelibrary.w iley.com /doi/10.1111/jcm m .70494 by IN A SP - N E PA L , W iley O nline L ibrary on [21/03/2025].
Western Blot:Article Title: NPAS2 Contributes to Liver Fibrosis by Direct Transcriptional Activation of Hes1 in Hepatic Stellate Cells
Article Snippet: .. Antibody Company (Cat. No.) Working dilutions NPAS2 NOVUS (NBP1-31363) WB: 1/1000,IHC:1/200 Hes1 Abcam (ab71559) WB: 1/1000,IHC:1/200 Colα1 Abcam(ab34710) WB: 1/2000,IHC:1/400 α-SMA Proteintech (14395-1-AP) WB: 1/800, IHC:1/400 Notch2 Cell Signaling (#5732) WB: 1/1000 Notch3 Cell Signaling (#4053) WB: 1/1000 Jag1 Proteintech (66890-1-Ig) WB: 1/5000 Hey2 Proteintech (10597-1-AP) WB: 1/1000 β-actin Beijing TDY (TDY051C) WB: 1/3000 ..
Article Title: RB1CC1-enhanced autophagy facilitates PSCs activation and pancreatic fibrogenesis in chronic pancreatitis
Article Snippet: .. Upper Primer: 5' GAAAATGCCACTTGCCTTTATGC 3' 64 Lower Primer: 5' AGGAAAAGCCAGGTCCGAAC 3' 65 GAPDH (Human) 66 5.Antibodies for Western blot assays 69 Antibody Company Dilution α-SMA ProteinTech (14395-1-AP) 1:2000 Collagen I ProteinTech (14695-1-AP) 1:1000 Collagen III ProteinTech (22734-1-AP) 1:1000 Fibronectin ProteinTech (15613-1-AP) 1:1000 BAX ProteinTech (50599-2-IG) 1:2000 MMP-2 ProteinTech (10373-2-AP) 1:1000 MMP-9 ProteinTech (10375-2-AP) 1:1000 ATG5 Abcam (ab108327) 1:1000 ATG7 Abcam (ab133528) 1:1000 LC3 Cell Signaling Technologies (3868) 1:2000 P62 Cell Signaling Technologies (5114) 1:2000 Beclin1 Cell Signaling Technologies (3495) 1:2000 ULK1 Cell Signaling Technologies (8054) 1:1000 p-ULK1 Cell Signaling Technologies (5869) 1:1000 BCL-2 Santa Cruz Biotechnology (sc-7382) 1:1000 TGF-β Invitrogen (MA5-16949) 1:2000 GAPDH Kangcheng (KC-5G5) 1:4000 β-actin Santa Cruz Biotechnology (sc-58673) 1:3000 Secondary antibodies Santa Cruz Biotechnology (sc-2004, sc2005) 1:10000 6.Antibodies for immunohistochemistry assays 70 Antibody Company Dilution RB1CC1 ProteinTech (17250-1-AP) 1:200 ULK1 ProteinTech (20986-1-AP) 1:200 Collagen I ProteinTech (14695-1-AP) 1:200 Collagen III ProteinTech (22734-1-AP) 1:200 LC3B Cell Signaling Technologies (3868) 1:200 α-SMA Cell Signaling Technologies (19245) 1:200 Beclin1 Cell Signaling Technologies (3495) 1:200 LAMP-2 Invitrogen (PA1-655) 1:200 71 Reference 72 1. ..
Article Title: YAP1 Inhibition Induces Phenotype Switching of Cancer-Associated Fibroblasts to Tumor Suppressive in Prostate Cancer
Article Snippet: .. COL1A1 Thermo Fisher Scientific PA5-29569 Rabbit IF: 1/200 WB: 1/1000 TSG6 Proteintech 13321-1 Rabbit IF: 1/200 WB: 1/1000 α-SMA Proteintech 80008-1 Rabbit IF: 1/200 WB: 1/5000 NF-κB P65 Proteintech 10745-1 Rabbit IF: 1/200 WB: 1/1000 NF-κB P-P65 Cell Signaling Technology 3033 Rabbit WB: 1/1000 YAP1 Proteintech 13584-1 Rabbit IF: 1/200 WB: 1/1000 YAP1 Santa Cruz Sc-376830 Mouse IF: 1/200 P-YAP1 Cell Signaling Technology 13008 Rabbit WB: 1/1000 IKKα Abcam Ab32041 Rabbit WB: 1/2000 P-IKKα/β Cell Signaling Technology 2697 Rabbit WB: 1/1000 P-IκBα Cell Signaling Technology 2859 Rabbit WB: 1/1000 CD8 Cell Signaling Technology 85336 Rabbit IF: 1/100 GAPDH Proteintech 10494-1 Rabbit WB: 1/5000 ..
Article Title: NPAS2 Contributes to Liver Fibrosis by Direct Transcriptional Activation of Hes1 in Hepatic Stellate Cells
Article Snippet: .. Antibody Company (Cat. No.) Working dilutions NPAS2 NOVUS (NBP1-31363) WB: 1/1000,IHC:1/200 Hes1 Abcam (ab71559) WB: 1/1000,IHC:1/200 Colα1 Abcam(ab34710) WB: 1/2000,IHC:1/400 α-SMA Proteintech (14395-1-AP) WB: 1/800, IHC:1/400 Notch2 Cell Signaling (#5732) WB: 1/1000 Notch3 Cell Signaling (#4053) WB: 1/1000 Jag1 Proteintech (66890-1-Ig) WB: 1/5000 Hey2 Proteintech (10597-1-AP) WB: 1/1000 β-actin Beijing TDY (TDY051C) WB: 1/3000 ..
Immunohistochemistry:Article Title: NPAS2 Contributes to Liver Fibrosis by Direct Transcriptional Activation of Hes1 in Hepatic Stellate Cells
Article Snippet: .. Antibody Company (Cat. No.) Working dilutions NPAS2 NOVUS (NBP1-31363) WB: 1/1000,IHC:1/200 Hes1 Abcam (ab71559) WB: 1/1000,IHC:1/200 Colα1 Abcam(ab34710) WB: 1/2000,IHC:1/400 α-SMA Proteintech (14395-1-AP) WB: 1/800, IHC:1/400 Notch2 Cell Signaling (#5732) WB: 1/1000 Notch3 Cell Signaling (#4053) WB: 1/1000 Jag1 Proteintech (66890-1-Ig) WB: 1/5000 Hey2 Proteintech (10597-1-AP) WB: 1/1000 β-actin Beijing TDY (TDY051C) WB: 1/3000 ..
Article Title: RB1CC1-enhanced autophagy facilitates PSCs activation and pancreatic fibrogenesis in chronic pancreatitis
Article Snippet: .. Upper Primer: 5' GAAAATGCCACTTGCCTTTATGC 3' 64 Lower Primer: 5' AGGAAAAGCCAGGTCCGAAC 3' 65 GAPDH (Human) 66 5.Antibodies for Western blot assays 69 Antibody Company Dilution α-SMA ProteinTech (14395-1-AP) 1:2000 Collagen I ProteinTech (14695-1-AP) 1:1000 Collagen III ProteinTech (22734-1-AP) 1:1000 Fibronectin ProteinTech (15613-1-AP) 1:1000 BAX ProteinTech (50599-2-IG) 1:2000 MMP-2 ProteinTech (10373-2-AP) 1:1000 MMP-9 ProteinTech (10375-2-AP) 1:1000 ATG5 Abcam (ab108327) 1:1000 ATG7 Abcam (ab133528) 1:1000 LC3 Cell Signaling Technologies (3868) 1:2000 P62 Cell Signaling Technologies (5114) 1:2000 Beclin1 Cell Signaling Technologies (3495) 1:2000 ULK1 Cell Signaling Technologies (8054) 1:1000 p-ULK1 Cell Signaling Technologies (5869) 1:1000 BCL-2 Santa Cruz Biotechnology (sc-7382) 1:1000 TGF-β Invitrogen (MA5-16949) 1:2000 GAPDH Kangcheng (KC-5G5) 1:4000 β-actin Santa Cruz Biotechnology (sc-58673) 1:3000 Secondary antibodies Santa Cruz Biotechnology (sc-2004, sc2005) 1:10000 6.Antibodies for immunohistochemistry assays 70 Antibody Company Dilution RB1CC1 ProteinTech (17250-1-AP) 1:200 ULK1 ProteinTech (20986-1-AP) 1:200 Collagen I ProteinTech (14695-1-AP) 1:200 Collagen III ProteinTech (22734-1-AP) 1:200 LC3B Cell Signaling Technologies (3868) 1:200 α-SMA Cell Signaling Technologies (19245) 1:200 Beclin1 Cell Signaling Technologies (3495) 1:200 LAMP-2 Invitrogen (PA1-655) 1:200 71 Reference 72 1. ..
Article Title: NPAS2 Contributes to Liver Fibrosis by Direct Transcriptional Activation of Hes1 in Hepatic Stellate Cells
Article Snippet: .. Antibody Company (Cat. No.) Working dilutions NPAS2 NOVUS (NBP1-31363) WB: 1/1000,IHC:1/200 Hes1 Abcam (ab71559) WB: 1/1000,IHC:1/200 Colα1 Abcam(ab34710) WB: 1/2000,IHC:1/400 α-SMA Proteintech (14395-1-AP) WB: 1/800, IHC:1/400 Notch2 Cell Signaling (#5732) WB: 1/1000 Notch3 Cell Signaling (#4053) WB: 1/1000 Jag1 Proteintech (66890-1-Ig) WB: 1/5000 Hey2 Proteintech (10597-1-AP) WB: 1/1000 β-actin Beijing TDY (TDY051C) WB: 1/3000 ..
|
Proteintech is a verified supplier 